Name	Consensus motif	Author	Title	Reference
ABFs binding site motif	CACGTGGC	Guiltinan MJ, Marcotte WR Jr, Quatrano RS.	A plant leucine zipper protein that recognizes an abscisic acid response element	Science 250:267-270 (1990)
ABRE binding site motif	(C/T)ACGTGGC	Choi H, Hong J, Ha J, Kang J, Kim SY	ABFs, a family of ABA-responsive element binding factors	J Biol Chem. 275: 1723-1730 (2000)
ABRE-like binding site motif	(C/G/T)ACGTG(G/T)(A/C)	Shinozaki K., Yamaguchi-Shinozaki K.	Molecular responses to dehydration and low temperature	Curr. Opin. Plant Biol. (2000) 3:217-223
ACE promoter motif	GACACGTAGA	Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B	Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system	Plant Mol Biol (1998) 36: 741-754
AG binding site motif	TT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG(A/C/T)	Shiraishi H, Okada K, Shimura Y	Nucleotide sequences recognized by the AGAMOUS MADS domain of Arabidopsis thaliana in vitro	Plant J 4: 385-398 (1993)
AG BS in AP3	CCATTTTTAGT	Tilly J. J., Allen D. W., Jack T.	The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	Development 125:1647-1657 (1998)
AG BS in SUP	CCATTTTTGG	Riechmann J. L., Krizek B. A., Meyerowitz E. M.	Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS	Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996)
AGL1 binding site motif	NTT(A/G/T)CC(A/T)(A/T)(A/T)(A/T)NNGG(A/T)AAN	Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H	DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation	Plant Cell 8: 81-94 (1996)
AGL2 binding site motif	NN(A/T)NCCA(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)(A/T)AN	Huang H, Tudor M, Su T, Zhang Y, Hu Y, Ma H	DNA binding properties of two Arabidopsis MADS domain proteins: binding consensus and dimer formation	Plant Cell 8: 81-94 (1996)
AGL3 binding site motif	TT(A/T)C(C/T)A(A/T)(A/T)(A/T)(A/T)T(A/G)G(A/T)AA	Huang H, Tudor M, Weiss CA, Hu Y, Ma H	The Arabidopsis MADS-box gene AGL3 is widely expressed and encodes a sequence-specific DNA-binding protein	Plant Mol Biol 28:549-567 (1995)
AP1 BS in AP3	CCATTTTTAG	Tilly J. J., Allen D. W., Jack T.	The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects	Development 125:1647-1657 (1998)
AP1 BS in SUP	CCATTTTTGG	Riechmann J. L., Krizek B. A., Meyerowitz E. M.	Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS	Proc. Natl. Acad. Sci. USA 93:4793-4798 (1996).
ARF binding site motif	TGTCTC	Ulmasov T, Hagen G, Guilfoyle TJ	Dimerization and DNA binding of auxin response factors	Plant J 19:309-319 (1999)
ARF1 binding site motif	TGTCTC	Ulmasov T, Hagen G, Guilfoyle TJ	Dimerization and DNA binding of auxin response factors	Plant J 19:309-319 (1999)
ATHB1 binding site motif	CAAT(A/T)ATTG	Sessa G, Morelli G, Ruberti I	The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities	EMBO J 12:3507-3517 (1993)
ATHB2 binding site motif	CAAT(C/G)ATTG	Sessa G, Morelli G, Ruberti I	The Athb-1 and -2 HD-Zip domains homodimerize forming complexes of different DNA binding specificities	EMBO J 12:3507-3517 (1993)
ATHB5 binding site motif	CAATNATTG	Johannesson H, Wang Y, Engstrom P.	DNA-binding and dimerization preferences of Arabidopsis homeodomain-leucine zipper transcription factors in vitro	Plant Mol Biol 45: 63-73 (2001)
ATHB6 binding site motif	CAATTATTA	Himmelbach A, Hoffmann T, Leube M, Hohener B, Grill E.	Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis	EMBO J. 21:3029-3038 (2002)
AtMYB2 BS in RD22	CTAACCA	Shinozaki K	Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.	Plant Cell 9:1859-1868 (1997)
AtMYC2 BS in RD22	CACATG	Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K	Role of Arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.	Plant Cell 9:1859-1868 (1997)
Box II promoter motif	GGTTAA	Le Gourrierec J, Li YF, Zhou DX.	Transcriptional activation by Arabidopsis GT-1 may be through interaction with TFIIA-TBP-TATA complex	Plant J. 1999 Jun;18(6):663-8.
CArG promoter motif	CC(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)GG	Hepworth SR, Valverde F, Ravenscroft D, Mouradov A, Coupland G.	Antagonistic regulation of flowering-time gene SOC1 by CONSTANS and FLC via separate promoter motifs	EMBO J. 21: 4327-4337 (2002)
CArG1 motif in AP3	GTTTACATAAATGGAAAA	Tilly JJ, Allen DW, Jack T.	The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.	Development. 1998 May;125(9):1647-57
CArG2 motif in AP3	CTTACCTTTCATGGATTA	Tilly JJ, Allen DW, Jack T.	The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.	Development. 1998 May;125(9):1647-57
CArG3 motif in AP3	CTTTCCATTTTTAGTAAC	Tilly JJ, Allen DW, Jack T.	The CArG boxes in the promoter of the Arabidopsis floral organ identity gene APETALA3 mediate diverse regulatory effects.	Development. 1998 May;125(9):1647-57
CBF1 BS in cor15a	TGGCCGAC	Hao D, Yamasaki K, Sarai A, Ohme-Takagi M.	Determinants in the sequence specific binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs.	Biochemistry. 2002 Apr 2;41(13):4202-8
CBF2 binding site motif	CCACGTGG	Pla M, Vilardell J, Guiltinan MJ, Marcotte WR, Niogret MF, Quatrano RS, Pages M	The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.	Plant Mol Biol 21:259-266 (1993)
CCA1 binding site motif	AA(A/C)AATCT	Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM.	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene	Plant cell 9:491-507 (1997)
CCA1 motif1 BS in CAB1	AAACAATCTA	Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene.	Plant cell 9:491-507 (1997)
CCA1 motif2 BS in CAB1	AAAAAAAATCTATGA	Wang Z-Y, Kenigsbuch D, Sun L, Harel E, Ong MS, Tobin EM	A myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene.	Plant cell 9:491-507 (1997)
DPBF1&2 binding site motif	ACACNNG	Kim SY, Chung HJ, Thomas TL.	Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system	Plant J 11: 1237-1251 (1997)
DRE promoter motif	TACCGACAT	Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K	Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor	Nat Biotechnol 17: 287-291 (1999)
DREB1&2 BS in rd29a	TACCGACAT	Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K	Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor	Nat Biotechnol 17: 287-291 (1999)
DRE-like promoter motif	(A/G/T)(A/G)CCGACN(A/T)	Chen W., Provart N. et al.	The Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses	Plant Cell (2002) 14:559-574
E2F binding site motif	TTTCCCGC	Chaboute ME, Clement B, Sekine M, Philipps G, Chaubet-Gigot N.	Cell cycle regulation of the tobacco ribonucleotide reductase small subunit gene is mediated by E2F-like elements	Plant Cell 12: 1987-2000 (2000)
E2F/DP BS in AtCDC6	TTTCCCGC	de Jager SM, Menges M, Bauer UM, Murra JA.	Arabidopsis E2F1 binds a sequence present in the promoter of S-phase-regulated gene AtCDC6 and is a member of a multigene family with differential activities.	Plant Mol Biol. 2001 Nov;47(4):555-68.
E2F-varient binding site motif	TCTCCCGCC	Ramirez-Parra E, Frundt C, Gutierrez C.	A genome-wide identification of E2F-regulated genes in Arabidopsis	Plant J. 2003 Feb;33(4):801-11.
EIL1 BS in ERF1	TTCAAGGGGGCATGTATCTTGAA	Solano R., Stepanova A., Chao Q., Ecker J. R.	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	Genes Dev. 12:3703-3714 (1998)
EIL2 BS in ERF1	TTCAAGGGGGCATGTATCTTGAA	Solano R., Stepanova A., Chao Q., Ecker J. R.	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	Genes Dev. 12:3703-3714 (1998).
EIL3 BS in ERF1	TTCAAGGGGGCATGTATCTTGAA	Solano R., Stepanova A., Chao Q., Ecker J. R.	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	Genes Dev. 12:3703-3714 (1998).
EIN3 BS in ERF1	GGATTCAAGGGGGCATGTATCTTGAATCC	Solano R, Stepanova A, Chao Q, Ecker JR	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	Genes Dev. 12: 3703-3714 (1998).
ERE promoter motif	TAAGAGCCGCC	Shinshi H, Usami S, Ohme-Takagi M.	Identification of an ethylene-responsive region in the promoter of a tobacco class I chitinase gene	Plant Mol Biol 27:923-932 (1995)
ERF1 BS in AtCHI-B	GCCGCC	Solano R., Stepanova A., Chao Q., Ecker J. R.	Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1	Genes Dev. 12:3703-3714 (1998)
EveningElement promoter motif	AAAATATCT	Harmer SL, Hogenesch JB, Straume M, Chang HS, Han B, Zhu T, Wang X, Kreps JA, Kay SA.	Orchestrated transcription of key pathways in Arabidopsis by the circadian clock	Science 290: 2110-3 (2000)
GATA promoter motif	(A/T)GATA(G/A)	Teakle GR, Manfield IW, Graham JF, Gilmartin PM.	Arabidopsis thaliana GATA factors: organisation, expression and DNA-binding characteristics	Plant Mol Biol. 2002 Sep;50(1):43-57.
GBF1/2/3 BS in ADH1	CCACGTGG	de Vetten N. C., Ferl R. J.	Characterization of a maize G-box binding factor that is induced by hypoxia	Plant J. 7:589-601 (1995).
G-box promoter motif	CACGTG	Menkens AE, Cashmore AR.	Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein	Proc Natl Acad Sci USA 91: 2522-2526 (1994)
GCC-box promoter motif	GCCGCC	Shinozaki K., Yamaguchi-Shinozaki K.	Molecular responses to dehydration and low temperature	Curr. Opin. Plant Biol. 3:217-223
GT promoter motif	TGTGTGGTTAATATG	Green PJ, Kay SA, Chua N-H.	Sequence-specific interactions of a pea nuclear factor with light-responsive elements upstream of the rbcS-3A gene.	EMBO J 6:2543-2549 (1987)
Hexamer promoter motif	CCGTCG	Chaubet N, Flenet M, Clement B, Brignon P, Gigot C.	Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene	Plant J 10:425-435 (1996)
HSEs binding site motif	AGAANNTTCT	Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD.	Arabidopsis and the heat stress transcription factor world: how many heat stress transcription factors do we need?	Cell Stress Chaperones. 2001 Jul;6(3):177-89. Review.
Ibox promoter motif	GATAAG	Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR.	An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene	Proc Natl Acad Sci USA 85:7089-7093 (1988)
JASE1 motif in OPR1	CGTCAATGAA	He Y, Gan S	Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis	Plant Mol Biol 47: 595-605 (2001)
JASE2 motif in OPR2	CATACGTCGTCAA	He Y, Gan S	Identical promoter elements are involved in regulation of the OPR1 gene by senescence and jasmonic acid in Arabidopsis	Plant Mol Biol 47: 595-605 (2001)
L1-box promoter motif	TAAATG(C/T)A	Abe M, Takahashi T, Komeda Y.	Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein	Plant J 26: 487-494 (2001)
LS5 promoter motif	ACGTCATAGA	Despres C, DeLong C, Glaze S, Liu E, Fobert PR	The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors	Plant Cell 12: 279-290 (2000)
LS7 promoter motif	TCTACGTCAC	Despres C, DeLong C, Glaze S, Liu E, Fobert PR	The Arabidopsis NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA family of bZIP transcription factors	Plant Cell 12: 279-290 (2000)
LTRE promoter motif	ACCGACA	Nordin K, Vahala T, Palva ET.	Differential expression of two related, low-temperature-induced genes in Arabidopsis thaliana (L.) Heynh	Plant Mol Biol 21:641-653 (1993)
MRE motif in CHS	TCTAACCTACCA	Hartmann U, Valentine WJ, Christie JM, Hays J, Jenkins GI, Weisshaar B	Identification of UV/blue light-response elements in the Arabidopsis thaliana chalcone synthase promoter using a homologous protoplast transient expression system	Plant Mol Biol (1998) 36: 741-754
MYB binding site promoter	(A/C)ACC(A/T)A(A/C)C	Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M.	A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes	EMBO J 13:128-137 (1994)
MYB1 binding site motif	(A/C)TCC(A/T)ACC	Menkens AE, Cashmore AR.	Isolation and characterization of a fourth Arabidopsis thaliana G-box-binding factor, which has similarities to Fos oncoprotein	Proc Natl Acad Sci USA 91: 2522-2526 (1994)
MYB2 binding site motif	TAACT(G/C)GTT	Martin C, Paz-Ares J.	MYB transcription factors in plants	Trends Genet. 13:67-73 (1997)
MYB3 binding site motif	TAACTAAC	Chen W., Provart N. et al.	Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses.	Plant Cell. 2002 Mar;14(3):559-74.
MYB4 binding site motif	A(A/C)C(A/T)A(A/C)C	Chen W., Provart N. et al.	Expression profile matrix of Arabidopsis transcription factor genes suggests their putative functions in response to environmental stresses.	Plant Cell. 2002 Mar;14(3):559-74.
Nonamer promoter motif	AGATCGACG	Chaubet N, Flenet M, Clement B, Brignon P, Gigot C.	Identification of cis-elements regulating the expression of an Arabidopsis histone H4 gene	Plant J 10:425-435 (1996)
OBF4,5 BS in GST6	ATCTTATGTCATTGATGACGACCTCC	Chen W, Chao G, Singh KB	The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites.	Plant J 10: 955-966 (1996)
OBP-1,4,5 BS in GST6	TACACTTTTGG	Chen W, Chao G, Singh KB	The promoter of a H202-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding RT	Plant J 10: 955-966 (1996)
OCS promoter motif	TGACG(C/T)AAG(C/G)(A/G)(A/C)T(G/T)ACG(C/T)(A/C)(A/	Bouchez D, Tokuhisa JG, Llewellyn DJ, Dennis ES, Ellis JG.	The ocs-element is a component of the promoters of several T-DNA and plant viral genes	EMBO J 8:4197-4204 (1989).
octamer promoter motif	CGCGGATC	Chaubet N, Philipps G, Chaboute M-E, Ehling M, Giot C.	Nucleotide sequences of two corn histone H3 genes. Genomic organization of the corn histone H3 and H4 genes	Plant Mol Biol 6:253-263 (1986)
PI promoter motif	GTGATCAC	Chan CS, Guo L, Shih MC.	Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana	Plant Mol Biol 46: 131-141 (2001)
PII promoter motif	TTGGTTTTGATCAAAACCAA	Chan CS, Guo L, Shih MC.	Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana	Plant Mol Biol 46: 131-141 (2001)
PRHA BS in PAL1	TAATTGACTCAATTA	Plesch G., Stoermann K., Torres J. T., Walden R., Somssich I. E.	Developmental and auxin-induced expression of the Arabidopsis prha homeobox gene	Plant J. 12:635-647 (1997)
RAV1-A binding site motif	CAACA	Kagaya Y, Ohmiya K, Hattori T.	RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants	Nucleic Acids Res 27: 470-478 (1999)
RAV1-B binding site motif	CACCTG	Kagaya Y, Ohmiya K, Hattori T.	RAV1, a novel DNA-binding protein, binds to bipartite recognition sequence through two distinct DNA-binding domains uniquely found in higher plants	Nucleic Acids Res 27: 470-478 (1999)
RY-repeat promoter motif	CATGCATG	Dickinson CD, Evans RP, Nielsen NC.	RY repeats are conserved in the 5 prime-flanking region of legume seed protein genes	Nucleic Acids Res 16:371 (1988)
SBP-box promoter motif	TNCGTACAA	Cardon G, Hohmann S, Klein J, Nettesheim K, Saedler H, Huijser P.	Molecular characterisation of the Arabidopsis SBP-box genes	Gene. 1999 Sep 3;237(1):91-104
T-box promoter motif	ACTTTG	Chan CS, Guo L, Shih MC.	Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase B subunit of Arabidopsis thaliana	Plant Mol Biol 46: 131-141 (2001).
TEF-box promoter motif	AGGGGCATAATGGTAA	Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B.	Plant interstitial telomere mitifs participate in the control of gene expression in root meristems	Plant J 20: 553-561 (1999)
TELO-box promoter motif	AAACCCTAA	Tremousayque D, Manevski A, Bardet C, Lescure N, Lescure B.	Plant interstitial telomere mitifs participate in the control of gene expression in root meristems	Plant J 20: 553-561 (1999)
TGA1 binding site motif	TGACGTGG	Schindler U, Beckmann H, Cashmore AR.	TGA1 and G-box binding factors: two distinct classes of Arabidopsis leucine zipper proteins compete for the G-box-like element TGACGTGG	Plant Cell 4: 1309-1319 (1992).
W-box promoter motif	TTGAC	Yu D, Chen C, Chen Z.	Evidence for an important role of WRKY DNA binding proteins in the regulation of NPR1 gene expression	Plant Cell 13: 1527-1540 (2001).
Z-box promoter motif	ATACGTGT	Ha SB, An G	Identification of upstream regulatory elements involved in the developmental expression of the Arabidopsis thaliana cab1 gene	Proc Natl Acad Sci USA 85: 8017-8021 (1988)
AG BS in SPL/NOZ	AAAACAGAATAGGAAA	Ito et al.	The homeotic protein AGAMOUS controls microsporogenesis by regulation of  SPOROCYTELESS	Nature, 430: 356-360 (2004)
Bellringer/replumless/pennywise BS1 IN AG	AAATTAAA	Bao X, Franks RG, Levin JG, Liu Z	Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems	Plant Cell 16: 1478-1489 (2004)
Bellringer/replumless/pennywise BS2 IN AG	AAATTAGT	Bao X, Franks RG, Levin JG, Liu Z	Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems	Plant Cell 16: 1478-1489 (2004)
Bellringer/replumless/pennywise BS3 IN AG	ACTAATTT	Bao X, Franks RG, Levin JG, Liu Z	Repression of AGAMOUS by BELLRINGER in Floral and Inflorescence Meristems	Plant Cell 16: 1478-1489 (2004)
AGL15 BS in AtGA2ox6	CCAATTTAATGG	Wang H, Caruso LV, Downie B, Perry SE	The Embryo MADS Domain Protein AGAMOUS-LIKE15 Directly Regulates Expression of a Gene Encoding an Enzyme Involved in Gibberellin Metabolism	Plant Cell 16: 1206-1219. (2004)
ATB2/AtbZIP53/AtbZIP44/GBF5 BS in ProDH	ACTCAT	Satoh et al	A Novel Subgroup of bZIP Proteins Functions as Transctiptional Activators in Hypsosmolarity-Responsive Expression of the ProDH gene in Arabidopsis	Plant Cell Physiol. 45(3):300-317. (2004)
LFY BS in AP3	CTTAAACCCTAGGGGTAAT	Lamb RS, Hill TA, Tan QKG, Irish VF	Regulation of APETALA3 floral homeotic gene expression by meristem identity genes	Development 129: 2079-2086. (2002)
SORLREP1	TT[AT]TACTAGT	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLREP2	ATAAAACGT	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLREP3	TGTATATAT	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLREP4	CTCCTAATT	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLREP5	TTGCATGACT	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLIP1	AGCCAC	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLIP2	GGGCC	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLIP3	CTCAAGTGA	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLIP4	GTATGATGG	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)
SORLIP5	GAGTGAG	Hudson M, Quail P	Identification of key promoter motifs involved in the network of light-regulated gene expression by combined analysis of genomic sequence and microarray data.	Plant Physiology.133. 1605–1616. (2003)

Comments & Suggestion	OSU	HCG Bioinformatics	OSC	PMBB	ABRC	Plant Cellular & Molecular Biology	NSF
Copyright © 2004. All rights reserved. Credits WebSite is best viewed by Netscape 7.0 or Micosoft Internet Explorer 6.0 or Safari For Mac Users or above with Java Applet support